Nueces

La red social para estudiantes de la UFV

Examen TAR Mayo 2018 – Biotecnología UFV

Examen de TAR (7 Mayo 2018)

Parte del Profesor Uno (4 puntos):

1 punto – 1. Del plásmido mostrado en la figura indica qué son y para qué sirven los siguientes elementos: pUC ori, ApR, 2 µm ori, URA3, MCS, ¿qué tipo de plásmido es? ¿Cuál es su principal ventaja? ¿Cuál es su principal inconveniente?

IMG_2213

1 punto – 2. Dispones del siguiente fragmento de DNA que presenta un gen que estás interesado en clonar. Dicho gen está flanqueado por las dianas de restricción EcoRI (G/AATTC).

5′ – GCCGAATTCGATCCTATGAACACGAAGCGAAAGTCTTAAAGATACCGAATTCGATTCG – 3′

Para ello, decides digerir el fragmento con EcoRI y ligarlo a uno de estos tres plásmidos que expresan la β-galactosidasa para realizar una proteína de fusión. Los tripletes GGC y AAC, codifican para los dos últimos aminoácidos de la β-galactosidasa. ¿Qué plásmido usarías para unir directamente tu fragmento? Razona tu respuesta.

pWR590-1: GGCAACCGGGCGAGCTCGAATTCGAAAGATTAG

pWR590-2: GGCAACCCGGGCGAGCTCGAATTCGAAAGATTAG

pWR590-3: GGCAACGGGGCAGCTCGAATTCGAGAAAGATTAG

2 puntos – 3a. Estás estudiando un gen específico de levadura, y quieres expresar dicho gen en E. coli. Debes diseñar una estrategia para insertar el gen de levadura en el plásmido bacteriano. Se muestra el mapa del área del genoma de levadura en la que está el gen de interés.

Screen Shot 2018-06-02 at 18.18.09.png

La distancia entre cada marca: 100 pb. S: SalI, X: XbaI, K: KpnI, N: NdeI, E: EcoRI.

Se muestran las enzimas de restricción que se pueden usar y su secuencia de corte:

IMG_2214.JPG

IMG_2214.2.JPG

Parte del Profesor Dos (3 puntos):

La ataxia espinocerebral tipo 1 es una enfermedad monogénica causada principalmente por la expansión de una repetición del trinucleótido CAG en el gen ATXN1, pero otras mutaciones contribuyen a la patogénesis. Los pacientes presentan neuropatías cuando tienen más de 55 años. Suponga que se ha hallado el homólogo en ratón con la secuencia muy conservada. En su laboratorio han decidido generar un modelo animal con el objetivo de investigar los efectos de la abolición del gen sobre la diferenciación neuronal, en adultos. La imagen representa el tránscrito primario de Atxn1, que tiene 9 exones; sólo el 8 y el 9 son codificantes.

Screen Shot 2018-11-21 at 20.10.16

Screen Shot 2018-06-02 at 20.14.55.png

Screen Shot 2018-06-02 at 20.15.23.png

Parte tipo test (3 puntos). Esta parte es la que tengo peor apuntada (demasiado rollo escribir todo, pero os dejo de qué iba la cosa):

  1. Si un DNA es cortado con XbaI (T/CTAGA) y se incuba con Klenow, dCTP y dTTP, será compatible con…
  2. Ver fenolización (qué es y qué hace).
  3. Pregunta sobre promotor Lac/promotor Trp.
  4. Pregunta sobre el carbono a marcar en el marcaje radioactivo del ATP (carbono alfa).
  5. Pregunta sobre ApR/TetR.
  6. ¿Cuál es la diana más probable que aparezca? Hay 3 dianas de 6 nt (algo rollo ABCDEF, BCDEFG, CDEFGH) y una de 4 nt (como CDEF).
  7. Técnicas de clonaje seamless.
  8. Pregunta sobre tipos de vectores.
  9. Número de copias de plásmido.
  10. ¿Probabilidad de que aparezca una secuencia de 6 nucleótidos?
  11. Pregunta sobre transgénesis vegetal.
  12. Pregunta sobre transgénesis vegetal.
  13. Pregunta sobre variantes PCR.
  14. Pregunta secuenciación automática.
  15. Pregunta sobre variantes PCR.
  16. Pregunta sobre tipos de vectores.
  17. Pregunta sobre gene targeting en células madre embrionarias (ES).
  18. La ventaja del gen neo para eliminar la función de un gen en un ratón KO es…
  19. Vector para expresar de forma estable un cDNA en células mitóticas: (a) Retro / (b) Lenti / (c) Adeno / (d) Adenoasociados.
  20. Pregunta sobre ZFN / TALENS / PAM.

próximo Publicación

Atrás Publicación

Dejar una contestacion

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios.

© 2019 Nueces

Tema de Anders Norén