Nueces

La red social para estudiantes de la UFV

Examen Genética Básica Sept 2015 – Biotecnología UFV

El siguiente examen tiene solución. Puedes solicitarla por correo electrónico.

1. (4 puntos) En un laboratorio que trabaja en la enfermedad de Huntington (enfermedad neurodegenerativa caracterizada por movimientos espasmódicos, rigidez y demencia) se propuso utilizar Drosophila como organismo modelo para estudiar esta enfermedad.

Drosophila tiene un par de cromosomas sexuales (XX, XY) y tres pares de autosomas, denominados II, III y IV. En Drosophila los machos no sufren recombinación meiótica.

A partir de una mutagénesis con EMS se generaron dos líneas puras, independientes, que desarrollaban fenotipo Huntington con distinta expresividad: la línea 1 presentaba un fenotipo fuerte y la línea 2 un fenotipo débil.

Para caracterizar el gen o genes responsables del fenotipo Huntington se realizaron los siguientes cruces:

a)

b) Machos de la línea 1 se cruzaron con hembras mutantes para dos genes marcadores, vestigial (alas pequeñas, alelo mutante recesivo, en el cromosoma II) y rough eye (ojos rugosos, alelo mutante recesivo, en el cromosoma III). Los machos de la F1 se cruzaron con hembras de la línea parental mutante para los marcadores. La F2 resultante se muestra en la siguiente tabla:

c) En el cruce recíproco (hembras vírgenes de la F1 por machos de la línea parental mutante para los marcadores), se obtuvo la siguiente F2:

d) Al cruzar la línea 2 con la línea mutante para los marcadores, los resultados fueron muy similares a los obtenidos con la línea 1.

 

e) Por otro lado, generó una línea transgénica, pura, que portaba el gen de la proteína Huntingtina humano. Realizó los siguientes cruces:

Determine de manera razonada:

  1. El número de genes y de alelos implicados en el fenotipo Huntington en Drosophila y su relación de dominancia (1 punto).
  2. Los genotipos de la F1 y de la F2 en los cruces b) y c). (1 punto).
  3. La localización del gen o genes responsable(s) del fenotipo Huntington y su distancia a los genes marcadores. (1 punto).
  4. La localización cromosómica del transgén de la Huntingtina humano (1 punto).

2. (2 puntos) El siguiente pedigrí muestra el patrón de herencia de la enfermedad de Huntington bajo las siguientes condiciones: (i) los individuos no afectados de la primera generación no portan el alelo mutante, y (ii) los individuos que entran en el pedigrí no portan el alelo mutante.

Determine si dicho patrón corresponde con alguna de las alternativas presentadas:

a)  Monogénica, ligada al sexo, recesiva.

b)  Monogénica, autosómica, dominante, con expresividad variable.

c)  Monogénica, autosómica, dominante, con impronta paterna.

d)  Alteración mitocondrial.

3. (1 punto) Para mapear el gen responsable de la enfermedad en humanos, se realizó un análisis de ligamiento con marcadores en distintos cromosomas. Discuta los resultados presentados en la siguiente tabla:

4. (3 puntos) La enfermedad de Huntington está causada por la repetición de Gln en el extremo N terminal de la proteína Huntingtina (HTT). En individuos sanos el número de repeticiones oscila entre 9-36; más de 37 repeticiones se asocian a la aparición de la enfermedad. El navegador Ensembl localiza el gen HTT entre los nucleótidos 3,074,681- 3,243,959 (forward strand). El principal tránscrito funcional tiene 67 exones, todos codificantes. La secuencia del primer exón es:

GCTGCCGGGACGGGTCCAAGATGGACGGCCGCTCAGGTTCTGCTTTTACCTGCGGCCCAG AGCCCCATTCATTGCCCCGGTGCTGAGCGGCGCCGCGAGTCGGCCCGAGGCCTCCGGGGA CTGCCGTGCCGGGCGGGAGACCGCCATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGA GTCCCTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCC TCAGCCGCCGCCGCAGGCACAGCCGCTGCTGCCTCAGCCGCAGCCGCCCCCGCCGCCGCC CCCGCCGCCACCCGGCCCGGCTGTGGCTGAGGAGCCGCTGCACCGACC

a)  Discuta la conveniencia de utilizar la técnica de FISH para diagnosticar la enfermedad.

b)  Localice el primer nucleótido que se transcribe (+1) y el codón de iniciación del gen HTT. A partir de la información disponible, ¿podría decir si esta secuencia corresponde a un individuo sano o enfermo?

c)  Diseñe los oligos (12nts) que considere oportunos para el análisis por MLPA del exón 1 completo de HTT.

 

próximo Publicación

Atrás Publicación

Dejar una contestacion

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios.

© 2019 Nueces

Tema de Anders Norén